Peptide Search
 
 

Sequences OK!

Sequence consists of one FASTA entry

Starting Blastquery on server...

>Troponin C type 1 (slow) ENST00000496590 CAGCTGTCCTTCGGGCCACCCAGCTTGAGTTTCATCAGGGGCCGAAAGGGCATTGAGTGG TCACTGACTATTGTTACTGAGGGTCACCTTGGTCCTGAAGGGGGTGCCCACCTGTCACCC TGGCCCTGAGCCCAGTCGCAGTGAGGCCAGCTGGGTCACGTCAGGGCTTTGGGGGCAGGG AGGGAGGACTGAGACCTCCACTCTGTGGCCTGGAAATAGCCTGCCTCCTCCAGCTCCAGC CTTCTCACCTGTGGAATGGGTTGGTTTCCTCAGCAGCAGCTATACCTGAGTCTGAGCCTT GAGATTCCCTTTCCTTTCTAGGTAGAGCAGCTGACAGAAGAGCAGAAAAATGAGTTCAAG GCAGCCTTCGACATCTTCGTGCTGGGCGCTGAGGATGGCTGCATCAGCACCAAGGAGCTG GGCAAGGTGATGAGGATGCTGGGCCAGAACCCCACCCCTGAGGAGCTGCAGGAGATGATC GATGAGGTGGACGAGGACGGCAGCGGCACGGTGGACTTTGATGAGTTCCTGGTCATGATG GTTCGGTGCATGAAGGACGACAGCAAAGGGAAATCTGAGGAGGAGCTGTCTGACCTCTTC CGCATGTTTGACAAAAATGCTGATGGCTACATCGACCTGGATGAGCTGAAGATAATGCTG CAGGCTACAGGCGAGACCATCACGGAGGACGACATCGAGGAGCTCATGAAGGACGGAGAC AAGAACA

...ready!

Display Results as plain text

Bild nicht da

							

BLASTN 2.2.21 [Jun-14-2009] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= Troponin C type 1 (slow) ENST00000496590 (727 letters) Database: ALLNEWT 26,592 sequences; 17,090,221 total letters Searching..................................................done Score E

Erstelle Grafik!

Sequences producing significant alignments: (bits) Value Contig4032#estMolchPhred-CL88_c5#length=895 members=39# 436 e-122 Contig4576#estMolchPhred-CL88_c6#length=860 members=9# 428 e-119 Contig10082#estMolchPhred-CL88_c11#length=631 members=2# 412 e-115 Contig4700#estMolchPhred-CL88_c4#length=759 members=8# 412 e-115 Contig5946#estMolchPhred-CL88_c8#length=643 members=4# 412 e-115 Contig10083#estMolchPhred-CL88_c2#length=619 members=2# 406 e-113 Contig10084#estMolchPhred-CL88_c3#length=634 members=2# 404 e-112 Contig10085#estMolchPhred-CL88_c9#length=633 members=2# 404 e-112 Contig4404#estMolchPhred-CL88_c7#length=749 members=11# 404 e-112 Contig5364#estMolchPhred-CL88_c10#length=634 members=5# 404 e-112 Contig10081#estMolchPhred-CL88_c1#length=656 members=2# 396 e-110 Contig13447#F-Plate028-ML_28-P6.ab1#wcdID=34602 length=584 map=C... 367 e-101 Contig23492#F-Plate161-KB_26-J15.ab1#wcdID=7541 length=553 map=C... 329 7e-90 Contig29341#F-Plate204-KB_69-B21.ab1#wcdID=24489 length=537 map=... 321 2e-87 Contig12819#F-Plate024-ML_24-H6.ab1#wcdID=32988 length=497 map=C... 281 2e-75 Contig18148#F-Plate114-TB_5-D3.ab1#wcdID=40661 length=480 map=si... 58 4e-08 Contig6199#estMolchPhred-CL1778_c2#length=654 members=3# 58 4e-08 Contig6198#estMolchPhred-CL1778_c1#length=668 members=3# 54 6e-07
>Contig4032#estMolchPhred-CL88_c5#length=895 members=39# Length = 895 Score = 436 bits (220), Expect = e-122 Identities = 355/400 (88%) Strand = Plus / Plus Query: 328 cagctgacagaagagcagaaaaatgagttcaaggcagccttcgacatcttcgtgctgggc 387 |||||||| ||||||||||||||||||||| ||| || |||||||||||||||||||| Sbjct: 306 cagctgacggaagagcagaaaaatgagttccgggcggctttcgacatcttcgtgctgggt 365 Query: 388 gctgaggatggctgcatcagcaccaaggagctgggcaaggtgatgaggatgctgggccag 447 || |||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| Sbjct: 366 gcagaggatggctgcatcagcaccaaggagctggggaaggtgatgaggatgctggggcag 425 Query: 448 aaccccacccctgaggagctgcaggagatgatcgatgaggtggacgaggacggcagcggc 507 |||||||| || |||||| ||||||||||||| || |||||||| |||||||| |||||| Sbjct: 426 aaccccactcccgaggagttgcaggagatgatagacgaggtggatgaggacgggagcggc 485 Query: 508 acggtggactttgatgagttcctggtcatgatggttcggtgcatgaaggacgacagcaaa 567 || |||||||| ||||||||||| ||||||||||| ||||||||||| |||||||||||| Sbjct: 486 actgtggacttcgatgagttccttgtcatgatggtccggtgcatgaaagacgacagcaaa 545 Query: 568 gggaaatctgaggaggagctgtctgacctcttccgcatgtttgacaaaaatgctgatggc 627 || || || ||||| |||||||| ||||||||||| |||||||||||||||||||||||| Sbjct: 546 ggaaagtcagaggaagagctgtcggacctcttccggatgtttgacaaaaatgctgatggc 605 Query: 628 tacatcgacctggatgagctgaagataatgctgcaggctacaggcgagaccatcacggag 687 ||||| ||||| || ||||| ||||| |||||| | || || || ||||||||||| || Sbjct: 606 tacattgacctcgaggagctaaagatcatgctggaagccactggagagaccatcaccgaa 665 Query: 688 gacgacatcgaggagctcatgaaggacggagacaagaaca 727 || ||||| || ||||| |||| |||||| |||||||||| Sbjct: 666 gatgacattgaagagctgatgagggacggcgacaagaaca 705 Contig4576#estMolchPhred-CL88_c6#length=860 members=9# Length = 861 Score = 428 bits (216), Expect = e-119 Identities = 354/400 (88%) Strand = Plus / Plus Query: 328 cagctgacagaagagcagaaaaatgagttcaaggcagccttcgacatcttcgtgctgggc 387 |||||||| ||||||||||||||||||||| ||| || |||||||||||||||||||| Sbjct: 276 cagctgacggaagagcagaaaaatgagttccgggcggctttcgacatcttcgtgctggga 335 Query: 388 gctgaggatggctgcatcagcaccaaggagctgggcaaggtgatgaggatgctgggccag 447 || |||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| Sbjct: 336 gcagaggatggctgcatcagcaccaaggagctggggaaggtgatgaggatgctgggacag 395 Query: 448 aaccccacccctgaggagctgcaggagatgatcgatgaggtggacgaggacggcagcggc 507 |||||||| || |||||| ||||||||||||| || |||||||| |||||||| ||||| Sbjct: 396 aaccccactcccgaggagttgcaggagatgatagacgaggtggatgaggacgggagcggt 455 Query: 508 acggtggactttgatgagttcctggtcatgatggttcggtgcatgaaggacgacagcaaa 567 || |||||||| ||||||||||| ||||||||||| ||||||||||| |||||||||||| Sbjct: 456 actgtggacttcgatgagttccttgtcatgatggtccggtgcatgaaagacgacagcaaa 515 Query: 568 gggaaatctgaggaggagctgtctgacctcttccgcatgtttgacaaaaatgctgatggc 627 || || || ||||| |||||||| ||||||||||| |||||||||||||||||||||||| Sbjct: 516 ggaaagtcagaggaagagctgtcggacctcttccggatgtttgacaaaaatgctgatggc 575 Query: 628 tacatcgacctggatgagctgaagataatgctgcaggctacaggcgagaccatcacggag 687 ||||| ||||| || ||||| ||||| |||||| | || || || ||||||||||| || Sbjct: 576 tacattgacctcgaggagctaaagatcatgctggaagccactggagagaccatcaccgaa 635 Query: 688 gacgacatcgaggagctcatgaaggacggagacaagaaca 727 || ||||| || ||||| |||| |||||| |||||||||| Sbjct: 636 gatgacattgaagagctgatgagggacggcgacaagaaca 675 Contig10082#estMolchPhred-CL88_c11#length=631 members=2# Length = 632 Score = 412 bits (208), Expect = e-115 Identities = 319/356 (89%) Strand = Plus / Plus Query: 328 cagctgacagaagagcagaaaaatgagttcaaggcagccttcgacatcttcgtgctgggc 387 |||||||| ||||||||||||||||||||| ||| || |||||||||||||||||||| Sbjct: 276 cagctgacggaagagcagaaaaatgagttccgggcggctttcgacatcttcgtgctggga 335 Query: 388 gctgaggatggctgcatcagcaccaaggagctgggcaaggtgatgaggatgctgggccag 447 || |||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| Sbjct: 336 gcagaggatggctgcatcagcaccaaggagctggggaaggtgatgaggatgctggggcag 395 Query: 448 aaccccacccctgaggagctgcaggagatgatcgatgaggtggacgaggacggcagcggc 507 |||||||| || |||||| ||||||||||||| || |||||||| |||||||| |||||| Sbjct: 396 aaccccactcccgaggagttgcaggagatgatagacgaggtggatgaggacgggagcggc 455 Query: 508 acggtggactttgatgagttcctggtcatgatggttcggtgcatgaaggacgacagcaaa 567 || |||||||| ||||||||||| ||||||||||| ||||||||||| |||||||||||| Sbjct: 456 actgtggacttcgatgagttccttgtcatgatggtccggtgcatgaaagacgacagcaaa 515 Query: 568 gggaaatctgaggaggagctgtctgacctcttccgcatgtttgacaaaaatgctgatggc 627 || || || ||||| |||||||| ||||||||||| |||||||||||||||||||||||| Sbjct: 516 ggaaagtcagaggaagagctgtcggacctcttccggatgtttgacaaaaatgctgatggc 575 Query: 628 tacatcgacctggatgagctgaagataatgctgcaggctacaggcgagaccatcac 683 ||||| ||||| || ||||| ||||| |||||| | || || || ||||||||||| Sbjct: 576 tacattgacctcgaggagctaaagatcatgctggaagccactggagagaccatcac 631 Contig4700#estMolchPhred-CL88_c4#length=759 members=8# Length = 759 Score = 412 bits (208), Expect = e-115 Identities = 319/356 (89%) Strand = Plus / Plus Query: 328 cagctgacagaagagcagaaaaatgagttcaaggcagccttcgacatcttcgtgctgggc 387 |||||||| ||||||||||||||||||||| ||| || |||||||||||||||||||| Sbjct: 392 cagctgacggaagagcagaaaaatgagttccgggcggctttcgacatcttcgtgctgggt 451 Query: 388 gctgaggatggctgcatcagcaccaaggagctgggcaaggtgatgaggatgctgggccag 447 || |||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| Sbjct: 452 gcagaggatggctgcatcagcaccaaggagctggggaaggtgatgaggatgctggggcag 511 Query: 448 aaccccacccctgaggagctgcaggagatgatcgatgaggtggacgaggacggcagcggc 507 |||||||| || |||||| ||||||||||||| || |||||||| |||||||| |||||| Sbjct: 512 aaccccactcccgaggagttgcaggagatgatagacgaggtggatgaggacgggagcggc 571 Query: 508 acggtggactttgatgagttcctggtcatgatggttcggtgcatgaaggacgacagcaaa 567 || |||||||| ||||||||||| ||||||||||| ||||||||||| |||||||||||| Sbjct: 572 actgtggacttcgatgagttccttgtcatgatggtccggtgcatgaaagacgacagcaaa 631 Query: 568 gggaaatctgaggaggagctgtctgacctcttccgcatgtttgacaaaaatgctgatggc 627 || || || ||||| |||||||| ||||||||||| |||||||||||||||||||||||| Sbjct: 632 ggaaagtcagaggaagagctgtcggacctcttccggatgtttgacaaaaatgctgatggc 691 Query: 628 tacatcgacctggatgagctgaagataatgctgcaggctacaggcgagaccatcac 683 ||||| ||||| || ||||| ||||| |||||| | || || || ||||||||||| Sbjct: 692 tacattgacctcgaggagctaaagatcatgctggaagccactggagagaccatcac 747 Contig5946#estMolchPhred-CL88_c8#length=643 members=4# Length = 644 Score = 412 bits (208), Expect = e-115 Identities = 319/356 (89%) Strand = Plus / Plus Query: 328 cagctgacagaagagcagaaaaatgagttcaaggcagccttcgacatcttcgtgctgggc 387 |||||||| ||||||||||||||||||||| ||| || |||||||||||||||||||| Sbjct: 277 cagctgacggaagagcagaaaaatgagttccgggcggctttcgacatcttcgtgctgggt 336 Query: 388 gctgaggatggctgcatcagcaccaaggagctgggcaaggtgatgaggatgctgggccag 447 || |||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| Sbjct: 337 gcagaggatggctgcatcagcaccaaggagctggggaaggtgatgaggatgctggggcag 396 Query: 448 aaccccacccctgaggagctgcaggagatgatcgatgaggtggacgaggacggcagcggc 507 |||||||| || |||||| ||||||||||||| || |||||||| |||||||| |||||| Sbjct: 397 aaccccactcccgaggagttgcaggagatgatagacgaggtggatgaggacgggagcggc 456 Query: 508 acggtggactttgatgagttcctggtcatgatggttcggtgcatgaaggacgacagcaaa 567 || |||||||| ||||||||||| ||||||||||| ||||||||||| |||||||||||| Sbjct: 457 actgtggacttcgatgagttccttgtcatgatggtccggtgcatgaaagacgacagcaaa 516 Query: 568 gggaaatctgaggaggagctgtctgacctcttccgcatgtttgacaaaaatgctgatggc 627 || || || ||||| |||||||| ||||||||||| |||||||||||||||||||||||| Sbjct: 517 ggaaagtcagaggaagagctgtcggacctcttccggatgtttgacaaaaatgctgatggc 576 Query: 628 tacatcgacctggatgagctgaagataatgctgcaggctacaggcgagaccatcac 683 ||||| ||||| || ||||| ||||| |||||| | || || || ||||||||||| Sbjct: 577 tacattgacctcgaggagctaaagatcatgctggaagccactggagagaccatcac 632 Contig10083#estMolchPhred-CL88_c2#length=619 members=2# Length = 619 Score = 406 bits (205), Expect = e-113 Identities = 301/333 (90%) Strand = Plus / Plus Query: 328 cagctgacagaagagcagaaaaatgagttcaaggcagccttcgacatcttcgtgctgggc 387 |||||||| ||||||||||||||||||||| ||| || |||||||||||||||||||| Sbjct: 276 cagctgacggaagagcagaaaaatgagttccgggcggctttcgacatcttcgtgctggga 335 Query: 388 gctgaggatggctgcatcagcaccaaggagctgggcaaggtgatgaggatgctgggccag 447 || |||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| Sbjct: 336 gcagaggatggctgcatcagcaccaaggagctggggaaggtgatgaggatgctgggacag 395 Query: 448 aaccccacccctgaggagctgcaggagatgatcgatgaggtggacgaggacggcagcggc 507 |||||||| || |||||| ||||||||||||| || |||||||| |||||||| |||||| Sbjct: 396 aaccccactcccgaggagttgcaggagatgatagacgaggtggatgaggacgggagcggc 455 Query: 508 acggtggactttgatgagttcctggtcatgatggttcggtgcatgaaggacgacagcaaa 567 || |||||||| ||||||||||| ||||||||||| ||||||||||| |||||||||||| Sbjct: 456 actgtggacttcgatgagttccttgtcatgatggtccggtgcatgaaagacgacagcaaa 515 Query: 568 gggaaatctgaggaggagctgtctgacctcttccgcatgtttgacaaaaatgctgatggc 627 || || || ||||| |||||||| ||||||||||| |||||||||||||||||||||||| Sbjct: 516 ggaaagtcagaggaagagctgtcggacctcttccggatgtttgacaaaaatgctgatggc 575 Query: 628 tacatcgacctggatgagctgaagataatgctg 660 ||||| ||||| || ||||| ||||| |||||| Sbjct: 576 tacattgacctcgaggagctaaagatcatgctg 608 Contig10084#estMolchPhred-CL88_c3#length=634 members=2# Length = 634 Score = 404 bits (204), Expect = e-112 Identities = 318/356 (89%) Strand = Plus / Plus Query: 328 cagctgacagaagagcagaaaaatgagttcaaggcagccttcgacatcttcgtgctgggc 387 |||||||| ||||||||||||||||||||| ||| || |||||||||||||||||||| Sbjct: 276 cagctgacggaagagcagaaaaatgagttccgggcggctttcgacatcttcgtgctgggt 335 Query: 388 gctgaggatggctgcatcagcaccaaggagctgggcaaggtgatgaggatgctgggccag 447 || |||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| Sbjct: 336 gcagaggatggctgcatcagcaccaaggagctggggaaggtgatgaggatgctgggacag 395 Query: 448 aaccccacccctgaggagctgcaggagatgatcgatgaggtggacgaggacggcagcggc 507 |||||||| || |||||| ||||||||||| | || |||||||| |||||||| |||||| Sbjct: 396 aaccccactcccgaggagttgcaggagatggtagacgaggtggatgaggacgggagcggc 455 Query: 508 acggtggactttgatgagttcctggtcatgatggttcggtgcatgaaggacgacagcaaa 567 || |||||||| ||||||||||| ||||||||||| ||||||||||| |||||||||||| Sbjct: 456 actgtggacttcgatgagttccttgtcatgatggtccggtgcatgaaagacgacagcaaa 515 Query: 568 gggaaatctgaggaggagctgtctgacctcttccgcatgtttgacaaaaatgctgatggc 627 || || || ||||| |||||||| ||||||||||| |||||||||||||||||||||||| Sbjct: 516 ggaaagtcagaggaagagctgtcggacctcttccggatgtttgacaaaaatgctgatggc 575 Query: 628 tacatcgacctggatgagctgaagataatgctgcaggctacaggcgagaccatcac 683 ||||| ||||| || ||||| ||||| |||||| | || || || ||||||||||| Sbjct: 576 tacattgacctcgaggagctaaagatcatgctggaagccactggagagaccatcac 631 Contig10085#estMolchPhred-CL88_c9#length=633 members=2# Length = 634 Score = 404 bits (204), Expect = e-112 Identities = 318/356 (89%) Strand = Plus / Plus Query: 328 cagctgacagaagagcagaaaaatgagttcaaggcagccttcgacatcttcgtgctgggc 387 |||||||| ||||||||||||||||||||| ||| || |||||||||||||||||||| Sbjct: 276 cagctgacggaagagcagaaaaatgagttccgggcggctttcgacatcttcgtgctgggt 335 Query: 388 gctgaggatggctgcatcagcaccaaggagctgggcaaggtgatgaggatgctgggccag 447 || |||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| Sbjct: 336 gcagaggatggctgcatcagcaccaaggagctggggaaggtgatgaggatgctggggcag 395 Query: 448 aaccccacccctgaggagctgcaggagatgatcgatgaggtggacgaggacggcagcggc 507 |||||||| ||||||||| ||||||||||||| || |||||||| ||||| || ||||| Sbjct: 396 aaccccactcctgaggagttgcaggagatgatagacgaggtggatgaggatggaagcggt 455 Query: 508 acggtggactttgatgagttcctggtcatgatggttcggtgcatgaaggacgacagcaaa 567 || |||||||| ||||||||||| ||||||||||| ||||||||||| |||||||||||| Sbjct: 456 actgtggacttcgatgagttccttgtcatgatggtccggtgcatgaaagacgacagcaaa 515 Query: 568 gggaaatctgaggaggagctgtctgacctcttccgcatgtttgacaaaaatgctgatggc 627 || || || ||||| |||||||| ||||||||||| |||||||||||||||||||||||| Sbjct: 516 ggaaagtcagaggaagagctgtcggacctcttccggatgtttgacaaaaatgctgatggc 575 Query: 628 tacatcgacctggatgagctgaagataatgctgcaggctacaggcgagaccatcac 683 ||||| ||||| || ||||| ||||| |||||| | || || || ||||||||||| Sbjct: 576 tacattgacctcgaggagctaaagatcatgctggaagccactggagagaccatcac 631 Contig4404#estMolchPhred-CL88_c7#length=749 members=11# Length = 750 Score = 404 bits (204), Expect = e-112 Identities = 318/356 (89%) Strand = Plus / Plus Query: 328 cagctgacagaagagcagaaaaatgagttcaaggcagccttcgacatcttcgtgctgggc 387 |||||||||||||||||||||||||||||| ||| || |||||||||||||||||||| Sbjct: 392 cagctgacagaagagcagaaaaatgagttccgggcggctttcgacatcttcgtgctgggt 451 Query: 388 gctgaggatggctgcatcagcaccaaggagctgggcaaggtgatgaggatgctgggccag 447 || |||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||| Sbjct: 452 gcagaggatggttgcatcagcaccaaggagctggggaaggtgatgaggatgctggggcag 511 Query: 448 aaccccacccctgaggagctgcaggagatgatcgatgaggtggacgaggacggcagcggc 507 |||||||| || |||||| ||||||||||||| || |||||||| |||||||| ||||| Sbjct: 512 aaccccactcccgaggagttgcaggagatgatagacgaggtggatgaggacgggagcggt 571 Query: 508 acggtggactttgatgagttcctggtcatgatggttcggtgcatgaaggacgacagcaaa 567 || |||||||| ||||||||||| ||||||||||| ||||||||||| |||||||||||| Sbjct: 572 actgtggacttcgatgagttccttgtcatgatggtccggtgcatgaaagacgacagcaaa 631 Query: 568 gggaaatctgaggaggagctgtctgacctcttccgcatgtttgacaaaaatgctgatggc 627 || || || ||||| |||||||| ||||||||||| |||||||||||||||||||||||| Sbjct: 632 ggaaagtcagaggaagagctgtcggacctcttccggatgtttgacaaaaatgctgatggc 691 Query: 628 tacatcgacctggatgagctgaagataatgctgcaggctacaggcgagaccatcac 683 ||||| ||||| || ||||| ||||| |||||| | || || || ||||||||||| Sbjct: 692 tacattgacctcgaggagctaaagatcatgctggaagccactggagagaccatcac 747 Contig5364#estMolchPhred-CL88_c10#length=634 members=5# Length = 635 Score = 404 bits (204), Expect = e-112 Identities = 318/356 (89%) Strand = Plus / Plus Query: 328 cagctgacagaagagcagaaaaatgagttcaaggcagccttcgacatcttcgtgctgggc 387 |||||||| ||||||||||||||||||||| ||| || |||||||||||||||||||| Sbjct: 277 cagctgacggaagagcagaaaaatgagttccgggcggctttcgacatcttcgtgctgggt 336 Query: 388 gctgaggatggctgcatcagcaccaaggagctgggcaaggtgatgaggatgctgggccag 447 || |||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| Sbjct: 337 gcagaggatggctgcatcagcaccaaggagctggggaaggtgatgaggatgctggggcag 396 Query: 448 aaccccacccctgaggagctgcaggagatgatcgatgaggtggacgaggacggcagcggc 507 |||||||| || |||||| ||||||||||||| || ||||| || |||||||| |||||| Sbjct: 397 aaccccactcccgaggagttgcaggagatgatagacgaggttgatgaggacgggagcggc 456 Query: 508 acggtggactttgatgagttcctggtcatgatggttcggtgcatgaaggacgacagcaaa 567 || |||||||| ||||||||||| ||||||||||| ||||||||||| |||||||||||| Sbjct: 457 actgtggacttcgatgagttccttgtcatgatggtccggtgcatgaaagacgacagcaaa 516 Query: 568 gggaaatctgaggaggagctgtctgacctcttccgcatgtttgacaaaaatgctgatggc 627 || || || ||||| |||||||| ||||||||||| |||||||||||||||||||||||| Sbjct: 517 ggaaagtcagaggaagagctgtcggacctcttccggatgtttgacaaaaatgctgatggc 576 Query: 628 tacatcgacctggatgagctgaagataatgctgcaggctacaggcgagaccatcac 683 ||||| ||||| || ||||| ||||| |||||| | || || || ||||||||||| Sbjct: 577 tacattgacctcgaggagctaaagatcatgctggaagccactggagagaccatcac 632 Contig10081#estMolchPhred-CL88_c1#length=656 members=2# Length = 656 Score = 396 bits (200), Expect = e-110 Identities = 317/356 (89%) Strand = Plus / Plus Query: 328 cagctgacagaagagcagaaaaatgagttcaaggcagccttcgacatcttcgtgctgggc 387 |||||||| ||||||||||||||||||||| ||| || |||||||||||||||||||| Sbjct: 276 cagctgacggaagagcagaaaaatgagttccgggcggctttcgacatcttcgtgctgggt 335 Query: 388 gctgaggatggctgcatcagcaccaaggagctgggcaaggtgatgaggatgctgggccag 447 || |||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||| Sbjct: 336 gcagaggatggttgcatcagcaccaaggagctggggaaggtgatgaggatgctggggcag 395 Query: 448 aaccccacccctgaggagctgcaggagatgatcgatgaggtggacgaggacggcagcggc 507 |||||||| || |||||| ||||||||||||| || |||||||| |||||||| ||||| Sbjct: 396 aaccccactcccgaggagttgcaggagatgatagacgaggtggatgaggacgggagcggt 455 Query: 508 acggtggactttgatgagttcctggtcatgatggttcggtgcatgaaggacgacagcaaa 567 || |||||||| ||||||||||| ||||||||||| ||||||||||| |||||||||||| Sbjct: 456 actgtggacttcgatgagttccttgtcatgatggtccggtgcatgaaagacgacagcaaa 515 Query: 568 gggaaatctgaggaggagctgtctgacctcttccgcatgtttgacaaaaatgctgatggc 627 || || || ||||| |||||||| ||||||||||| |||||||||||||||||||||||| Sbjct: 516 ggaaagtcagaggaagagctgtcggacctcttccggatgtttgacaaaaatgctgatggc 575 Query: 628 tacatcgacctggatgagctgaagataatgctgcaggctacaggcgagaccatcac 683 ||||| ||||| || ||||| ||||| |||||| | || || || ||||||||||| Sbjct: 576 tacattgacctcgaggagctaaagatcatgctggaagccactggagagaccatcac 631 Contig13447#F-Plate028-ML_28-P6.ab1#wcdID=34602 length=584 map=CL88_notAssembled# Length = 584 Score = 367 bits (185), Expect = e-101 Identities = 275/305 (90%) Strand = Plus / Plus Query: 328 cagctgacagaagagcagaaaaatgagttcaaggcagccttcgacatcttcgtgctgggc 387 |||||||| ||||||||||||||||||||| ||| || |||||||||||||||||||| Sbjct: 276 cagctgacggaagagcagaaaaatgagttccgggcggctttcgacatcttcgtgctgggt 335 Query: 388 gctgaggatggctgcatcagcaccaaggagctgggcaaggtgatgaggatgctgggccag 447 || |||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||| Sbjct: 336 gcagaggatggttgcatcagcaccaaggagctggggaaggtgatgaggatgctggggcag 395 Query: 448 aaccccacccctgaggagctgcaggagatgatcgatgaggtggacgaggacggcagcggc 507 |||||||| || |||||| ||||||||||||| || |||||||| |||||||| ||||| Sbjct: 396 aaccccactcccgaggagttgcaggagatgatagacgaggtggatgaggacgggagcggt 455 Query: 508 acggtggactttgatgagttcctggtcatgatggttcggtgcatgaaggacgacagcaaa 567 || |||||||| ||||||||||| ||||||||||| ||||||||||| |||||||||||| Sbjct: 456 actgtggacttcgatgagttccttgtcatgatggtccggtgcatgaaagacgacagcaaa 515 Query: 568 gggaaatctgaggaggagctgtctgacctcttccgcatgtttgacaaaaatgctgatggc 627 || || || ||||| ||||| || ||||||||||| |||||||||||||||||||||||| Sbjct: 516 ggaaagtcagaggaagagctttcggacctcttccggatgtttgacaaaaatgctgatggc 575 Query: 628 tacat 632 ||||| Sbjct: 576 tacat 580 Contig23492#F-Plate161-KB_26-J15.ab1#wcdID=7541 length=553 map=CL88_notAssembled# Length = 553 Score = 329 bits (166), Expect = 7e-90 Identities = 253/282 (89%) Strand = Plus / Plus Query: 328 cagctgacagaagagcagaaaaatgagttcaaggcagccttcgacatcttcgtgctgggc 387 |||||||| ||||||||||||||||||||| ||| || |||||||||||||||||||| Sbjct: 272 cagctgacggaagagcagaaaaatgagttccgggcggctttcgacatcttcgtgctgggt 331 Query: 388 gctgaggatggctgcatcagcaccaaggagctgggcaaggtgatgaggatgctgggccag 447 || |||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||| Sbjct: 332 gcagaggatggttgcatcagcaccaaggagctggggaaggtgatgaggatgctggggcag 391 Query: 448 aaccccacccctgaggagctgcaggagatgatcgatgaggtggacgaggacggcagcggc 507 |||||||| || |||||| ||||||||||||| || |||||||| |||||||| ||||| Sbjct: 392 aaccccactcccgaggagttgcaggagatgatagacgaggtggatgaggacgggagcggt 451 Query: 508 acggtggactttgatgagttcctggtcatgatggttcggtgcatgaaggacgacagcaaa 567 || |||||||| ||||||||||| ||||||||||| ||||||||||| |||||||||||| Sbjct: 452 actgtggacttcgatgagttccttgtcatgatggtccggtgcatgaaagacgacagcaaa 511 Query: 568 gggaaatctgaggaggagctgtctgacctcttccgcatgttt 609 || || || ||||| |||||||| ||||||||||| |||||| Sbjct: 512 ggaaagtcagaggaagagctgtcggacctcttccggatgttt 553 Contig29341#F-Plate204-KB_69-B21.ab1#wcdID=24489 length=537 map=CL88_notAssembled# Length = 537 Score = 321 bits (162), Expect = 2e-87 Identities = 237/262 (90%) Strand = Plus / Plus Query: 328 cagctgacagaagagcagaaaaatgagttcaaggcagccttcgacatcttcgtgctgggc 387 |||||||||||||||||||||||||||||| ||| || |||||||||||||||||||| Sbjct: 276 cagctgacagaagagcagaaaaatgagttccgggcggctttcgacatcttcgtgctgggt 335 Query: 388 gctgaggatggctgcatcagcaccaaggagctgggcaaggtgatgaggatgctgggccag 447 || |||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||| Sbjct: 336 gcagaggatggttgcatcagcaccaaggagctggggaaggtgatgaggatgctggggcag 395 Query: 448 aaccccacccctgaggagctgcaggagatgatcgatgaggtggacgaggacggcagcggc 507 |||||||| || |||||| ||||||||||||| || |||||||| |||||||| |||||| Sbjct: 396 aaccccactcccgaggagttgcaggagatgatagacgaggtggatgaggacgggagcggc 455 Query: 508 acggtggactttgatgagttcctggtcatgatggttcggtgcatgaaggacgacagcaaa 567 || |||||||| ||||||||||| ||||||||||| ||||||||||| |||||||||||| Sbjct: 456 actgtggacttcgatgagttccttgtcatgatggtccggtgcatgaaagacgacagcaaa 515 Query: 568 gggaaatctgaggaggagctgt 589 || || || ||||| ||||||| Sbjct: 516 ggaaagtcagaggaagagctgt 537 Contig12819#F-Plate024-ML_24-H6.ab1#wcdID=32988 length=497 map=CL88_notAssembled# Length = 497 Score = 281 bits (142), Expect = 2e-75 Identities = 202/222 (90%) Strand = Plus / Plus Query: 328 cagctgacagaagagcagaaaaatgagttcaaggcagccttcgacatcttcgtgctgggc 387 |||||||||||||||||||||||||||||| ||| || |||||||||||||||||||| Sbjct: 276 cagctgacagaagagcagaaaaatgagttccgggcggctttcgacatcttcgtgctggga 335 Query: 388 gctgaggatggctgcatcagcaccaaggagctgggcaaggtgatgaggatgctgggccag 447 || |||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||| Sbjct: 336 gcagaggatggttgcatcagcaccaaggagctggggaaggtgatgaggatgctggggcag 395 Query: 448 aaccccacccctgaggagctgcaggagatgatcgatgaggtggacgaggacggcagcggc 507 |||||||| || |||||| ||||||||||||| || |||||||| |||||||| |||||| Sbjct: 396 aaccccactcccgaggagttgcaggagatgatagacgaggtggatgaggacgggagcggc 455 Query: 508 acggtggactttgatgagttcctggtcatgatggttcggtgc 549 || |||||||| ||||||||||| ||||||||||| |||||| Sbjct: 456 actgtggacttcgatgagttccttgtcatgatggtccggtgc 497 Contig18148#F-Plate114-TB_5-D3.ab1#wcdID=40661 length=480 map=singleton# Length = 480 Score = 58.0 bits (29), Expect = 4e-08 Identities = 29/29 (100%) Strand = Plus / Plus Query: 459 tgaggagctgcaggagatgatcgatgagg 487 ||||||||||||||||||||||||||||| Sbjct: 239 tgaggagctgcaggagatgatcgatgagg 267 Contig6199#estMolchPhred-CL1778_c2#length=654 members=3# Length = 654 Score = 58.0 bits (29), Expect = 4e-08 Identities = 113/141 (80%) Strand = Plus / Plus Query: 402 catcagcaccaaggagctgggcaaggtgatgaggatgctgggccagaaccccacccctga 461 |||||||||||||||| |||| | || ||||||||||||||||||| ||| ||| || Sbjct: 201 catcagcaccaaggagttggggacagtcatgaggatgctgggccagaccccaaccaagga 260 Query: 462 ggagctgcaggagatgatcgatgaggtggacgaggacggcagcggcacggtggactttga 521 |||||| | | || || || || ||||||||||| || ||||| || | ||||| || Sbjct: 261 agagctggacgccatcatagaggaagtggacgaggatggtagcggtaccatcgacttcga 320 Query: 522 tgagttcctggtcatgatggt 542 |||||| ||||||||||||| Sbjct: 321 ggagttcttggtcatgatggt 341 Score = 48.1 bits (24), Expect = 4e-05 Identities = 33/36 (91%) Strand = Plus / Plus Query: 597 cttccgcatgtttgacaaaaatgctgatggctacat 632 ||||||||| |||||||| || |||||||||||||| Sbjct: 396 cttccgcatctttgacaagaacgctgatggctacat 431 Contig6198#estMolchPhred-CL1778_c1#length=668 members=3# Length = 668 Score = 54.0 bits (27), Expect = 6e-07 Identities = 42/47 (89%) Strand = Plus / Plus Query: 402 catcagcaccaaggagctgggcaaggtgatgaggatgctgggccaga 448 |||||||||||||||| |||| | || ||||||||||||||||||| Sbjct: 177 catcagcaccaaggagttggggacagtcatgaggatgctgggccaga 223 Database: ALLNEWT Posted date: Sep 27, 2010 3:27 PM Number of letters in database: 17,090,221 Number of sequences in database: 26,592 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 26592 Number of Hits to DB: 128,868 Number of extensions: 2038 Number of successful extensions: 2038 Number of sequences better than 1.0e-04: 18 Number of HSP's gapped: 2038 Number of HSP's successfully gapped: 19 Length of query: 727 Length of database: 17,090,221 Length adjustment: 17 Effective length of query: 710 Effective length of database: 16,638,157 Effective search space: 11813091470 Effective search space used: 11813091470 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 50 (99.1 bits) S1: 12 (24.3 bits) S2: 24 (48.1 bits)